Review





Similar Products

paper n a hek293t atcc crl 3216 oligonucleotides primers  (ATCC)
99
ATCC paper n a hek293t atcc crl 3216 oligonucleotides primers
Paper N A Hek293t Atcc Crl 3216 Oligonucleotides Primers, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/paper n a hek293t atcc crl 3216 oligonucleotides primers/product/ATCC
Average 99 stars, based on 1 article reviews
paper n a hek293t atcc crl 3216 oligonucleotides primers - by Bioz Stars, 2026-05
99/100 stars
  Buy from Supplier
paper n a cloning primers  (Thermo Fisher)
99
Thermo Fisher paper n a cloning primers
Paper N A Cloning Primers, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/paper n a cloning primers/product/Thermo Fisher
Average 99 stars, based on 1 article reviews
paper n a cloning primers - by Bioz Stars, 2026-05
99/100 stars
  Buy from Supplier
paper n a kras g12d conditional pcr primer 1 gtctttccccagcacagtgc  (Jackson Laboratory)
86
Jackson Laboratory paper n a kras g12d conditional pcr primer 1 gtctttccccagcacagtgc
Paper N A Kras G12d Conditional Pcr Primer 1 Gtctttccccagcacagtgc, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/paper n a kras g12d conditional pcr primer 1 gtctttccccagcacagtgc/product/Jackson Laboratory
Average 86 stars, based on 1 article reviews
paper n a kras g12d conditional pcr primer 1 gtctttccccagcacagtgc - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier
paper n a real time qpcr primers  (10X Genomics)
86
10X Genomics paper n a real time qpcr primers
Paper N A Real Time Qpcr Primers, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/paper n a real time qpcr primers/product/10X Genomics
Average 86 stars, based on 1 article reviews
paper n a real time qpcr primers - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier
paper n a random hexamer primer thermo fisher cat  (Thermo Fisher)
86
Thermo Fisher paper n a random hexamer primer thermo fisher cat
Paper N A Random Hexamer Primer Thermo Fisher Cat, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/paper n a random hexamer primer thermo fisher cat/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
paper n a random hexamer primer thermo fisher cat - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier
paper n a kctd1 ctd rev primer  (Addgene inc)
93
Addgene inc paper n a kctd1 ctd rev primer
Figure 1. Structure of full-length <t>KCTD1</t> (A) Ribbon diagram of the pentameric KCTD1 structure. Sodium and iodide ions are shown as gray and green spheres, respectively. (B) Previously determined KCTD5 structure (PDB 3DRY). (C) Single chain of KCTD1. An insertion in the CTD not found in KCTD5 is highlighted in red (helix) and green (b strand and coil). (D) Structure-based alignment of the CTDs of KCTD1, KCTD15, and KCTD5. See also Figure S1.
Paper N A Kctd1 Ctd Rev Primer, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/paper n a kctd1 ctd rev primer/product/Addgene inc
Average 93 stars, based on 1 article reviews
paper n a kctd1 ctd rev primer - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier
paper n a oligonucleotides primers  (Cyagen Biosciences)
92
Cyagen Biosciences paper n a oligonucleotides primers
Figure 1. Structure of full-length <t>KCTD1</t> (A) Ribbon diagram of the pentameric KCTD1 structure. Sodium and iodide ions are shown as gray and green spheres, respectively. (B) Previously determined KCTD5 structure (PDB 3DRY). (C) Single chain of KCTD1. An insertion in the CTD not found in KCTD5 is highlighted in red (helix) and green (b strand and coil). (D) Structure-based alignment of the CTDs of KCTD1, KCTD15, and KCTD5. See also Figure S1.
Paper N A Oligonucleotides Primers, supplied by Cyagen Biosciences, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/paper n a oligonucleotides primers/product/Cyagen Biosciences
Average 92 stars, based on 1 article reviews
paper n a oligonucleotides primers - by Bioz Stars, 2026-05
92/100 stars
  Buy from Supplier
paper n a lepr 3xha infusion  (OriGene)
96
OriGene paper n a lepr 3xha infusion
Figure 1. Structure of full-length <t>KCTD1</t> (A) Ribbon diagram of the pentameric KCTD1 structure. Sodium and iodide ions are shown as gray and green spheres, respectively. (B) Previously determined KCTD5 structure (PDB 3DRY). (C) Single chain of KCTD1. An insertion in the CTD not found in KCTD5 is highlighted in red (helix) and green (b strand and coil). (D) Structure-based alignment of the CTDs of KCTD1, KCTD15, and KCTD5. See also Figure S1.
Paper N A Lepr 3xha Infusion, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/paper n a lepr 3xha infusion/product/OriGene
Average 96 stars, based on 1 article reviews
paper n a lepr 3xha infusion - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier
paper n a bs seq primer  (OriGene)
96
OriGene paper n a bs seq primer
Figure 1. Structure of full-length <t>KCTD1</t> (A) Ribbon diagram of the pentameric KCTD1 structure. Sodium and iodide ions are shown as gray and green spheres, respectively. (B) Previously determined KCTD5 structure (PDB 3DRY). (C) Single chain of KCTD1. An insertion in the CTD not found in KCTD5 is highlighted in red (helix) and green (b strand and coil). (D) Structure-based alignment of the CTDs of KCTD1, KCTD15, and KCTD5. See also Figure S1.
Paper N A Bs Seq Primer, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/paper n a bs seq primer/product/OriGene
Average 96 stars, based on 1 article reviews
paper n a bs seq primer - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

Image Search Results


Figure 1. Structure of full-length KCTD1 (A) Ribbon diagram of the pentameric KCTD1 structure. Sodium and iodide ions are shown as gray and green spheres, respectively. (B) Previously determined KCTD5 structure (PDB 3DRY). (C) Single chain of KCTD1. An insertion in the CTD not found in KCTD5 is highlighted in red (helix) and green (b strand and coil). (D) Structure-based alignment of the CTDs of KCTD1, KCTD15, and KCTD5. See also Figure S1.

Journal: Structure (London, England : 1993)

Article Title: A BTB extension and ion-binding domain contribute to the pentameric structure and TFAP2A binding of KCTD1.

doi: 10.1016/j.str.2024.07.023

Figure Lengend Snippet: Figure 1. Structure of full-length KCTD1 (A) Ribbon diagram of the pentameric KCTD1 structure. Sodium and iodide ions are shown as gray and green spheres, respectively. (B) Previously determined KCTD5 structure (PDB 3DRY). (C) Single chain of KCTD1. An insertion in the CTD not found in KCTD5 is highlighted in red (helix) and green (b strand and coil). (D) Structure-based alignment of the CTDs of KCTD1, KCTD15, and KCTD5. See also Figure S1.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains E. coli BL21(DE3)R3-pRARE2 cells Structural Genomics Consortium (SGC) Addgene #26242 MACH T1 cells ThermoFisher C862003 Chemicals, peptides, and recombinant proteins Ni Sepharose High Performance histidine-tagged protein purification resin GE Healthcare 17526802 HiLoad 16/600 Superdex 200 pg Sigma Aldrich GE28-9893-35 Full length KCTD1 protein (a.a. 1–257) This paper N/A KCTD1DN27 protein (a.a. 28–257) This paper N/A KCTD1 BTB domain (a.a. 26–132) This paper N/A KCTD1 CTD domain (a.a. 132–257) This paper N/A TFAP2A peptide (Biotin-NADFQPPYFPPPYQ, Uniprot P05549-1 residues 50–63 This paper N/A Deposited data Structure of full-length KCTD1 (a.a. 1–257) This paper PDB: 9FOI Structure of KCTD1DN27 (a.a. 28–257) This paper PDB: 6S4L Oligonucleotides KCTD1 full length Fwd primer (Eurofin Genomics) TACTTCCAATCCATGTCAAGACCTCTGATCACTAGATCCCC This paper N/A KCTD1 full length Rev primer (Eurofin Genomics) TATCCACCTTTACTGTCAGTCCAGAGGCTCTTGCTTTATCCGG This paper N/A KCTD1DN27 Fwd primer (Eurofin Genomics) TACTTCCAATCCATGTCCAATGCGCCTGTCCACATTG This paper N/A KCTD1DN27 Rev primer (Eurofin Genomics) TATCCACCTTTACTGTCAGTCCAGAGGCTCTTGCTTTATCCGG This paper N/A KCTD1 BTB Fwd primer (Eurofin Genomics) TACTTCCAATCCATGACAAAATCCAATGCGCCTGTCCAC This paper N/A KCTD1 BTB Rev primer (Eurofin Genomics) TATCCACCTTTACTGTCATTCTCTGTCCTGCTTCCATCTTTCC This paper N/A KCTD1 CTD Fwd primer (Eurofin Genomics) TACTTCCAATCCATGGAAACTGGTCGATTTTCAAGGCCC This paper N/A KCTD1 CTD Rev primer (Eurofin Genomics) TATCCACCTTTACTGTCAGTCCAGAGGCTCTTGCTTTATCCGG This paper N/A Recombinant DNA pNIC-NHStIIT vector Structural Genomics Consortium (SGC) N/A pCDF-LIC vector Structural Genomics Consortium (SGC) N/A pNIC28-Bsa4 vector Structural Genomics Consortium (SGC) Addgene Plasmid #26103 pCMVHA1-KCTD1 (cDNA for KCTD1 PCR) MRC PPU Plasmid DU42183 Software and algorithms PyMOL 2.3.4 The PyMOL Molecular Graphics System, Version 2.3 Schrödinger, LLC https://pymol.org/2/#download (Continued on next page) Structure 32, 1–8.e1–e4, October 3, 2024 e1

Techniques:

Figure 2. An extended BTB domain in KCTD1 is required for TFAP2 binding (A) Pentameric BTB domain assembly highlighting one chain in orange. Inset shows interactions of the N-terminal BTB extension with the neighboring subunit. (B) Residues associated with SEN-causing mutations are clustered in the BTB domain structure and are shown in spacefill representation colored blue, or orange for Pro20. (C and D) Biolayer interferometry (BLI) measurements. Biotinylated TFAP2A peptide was immobilized on streptavidin-coated sensor tips. Full-length KCTD1 protein was titrated up to 20 mM to assess binding. (C) KCTD1 amino acid (aa) 28–257 shows no binding. (D) Full-length KCTD1 shows dose-dependent binding to TFAP2A with KD = 380 nM by BLI. Protein was buffered in 25 mM HEPES pH 7.5, 150 mM NaCl, 0.05% Tween 20, and 0.5 mM TCEP. See also Figure S4.

Journal: Structure (London, England : 1993)

Article Title: A BTB extension and ion-binding domain contribute to the pentameric structure and TFAP2A binding of KCTD1.

doi: 10.1016/j.str.2024.07.023

Figure Lengend Snippet: Figure 2. An extended BTB domain in KCTD1 is required for TFAP2 binding (A) Pentameric BTB domain assembly highlighting one chain in orange. Inset shows interactions of the N-terminal BTB extension with the neighboring subunit. (B) Residues associated with SEN-causing mutations are clustered in the BTB domain structure and are shown in spacefill representation colored blue, or orange for Pro20. (C and D) Biolayer interferometry (BLI) measurements. Biotinylated TFAP2A peptide was immobilized on streptavidin-coated sensor tips. Full-length KCTD1 protein was titrated up to 20 mM to assess binding. (C) KCTD1 amino acid (aa) 28–257 shows no binding. (D) Full-length KCTD1 shows dose-dependent binding to TFAP2A with KD = 380 nM by BLI. Protein was buffered in 25 mM HEPES pH 7.5, 150 mM NaCl, 0.05% Tween 20, and 0.5 mM TCEP. See also Figure S4.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains E. coli BL21(DE3)R3-pRARE2 cells Structural Genomics Consortium (SGC) Addgene #26242 MACH T1 cells ThermoFisher C862003 Chemicals, peptides, and recombinant proteins Ni Sepharose High Performance histidine-tagged protein purification resin GE Healthcare 17526802 HiLoad 16/600 Superdex 200 pg Sigma Aldrich GE28-9893-35 Full length KCTD1 protein (a.a. 1–257) This paper N/A KCTD1DN27 protein (a.a. 28–257) This paper N/A KCTD1 BTB domain (a.a. 26–132) This paper N/A KCTD1 CTD domain (a.a. 132–257) This paper N/A TFAP2A peptide (Biotin-NADFQPPYFPPPYQ, Uniprot P05549-1 residues 50–63 This paper N/A Deposited data Structure of full-length KCTD1 (a.a. 1–257) This paper PDB: 9FOI Structure of KCTD1DN27 (a.a. 28–257) This paper PDB: 6S4L Oligonucleotides KCTD1 full length Fwd primer (Eurofin Genomics) TACTTCCAATCCATGTCAAGACCTCTGATCACTAGATCCCC This paper N/A KCTD1 full length Rev primer (Eurofin Genomics) TATCCACCTTTACTGTCAGTCCAGAGGCTCTTGCTTTATCCGG This paper N/A KCTD1DN27 Fwd primer (Eurofin Genomics) TACTTCCAATCCATGTCCAATGCGCCTGTCCACATTG This paper N/A KCTD1DN27 Rev primer (Eurofin Genomics) TATCCACCTTTACTGTCAGTCCAGAGGCTCTTGCTTTATCCGG This paper N/A KCTD1 BTB Fwd primer (Eurofin Genomics) TACTTCCAATCCATGACAAAATCCAATGCGCCTGTCCAC This paper N/A KCTD1 BTB Rev primer (Eurofin Genomics) TATCCACCTTTACTGTCATTCTCTGTCCTGCTTCCATCTTTCC This paper N/A KCTD1 CTD Fwd primer (Eurofin Genomics) TACTTCCAATCCATGGAAACTGGTCGATTTTCAAGGCCC This paper N/A KCTD1 CTD Rev primer (Eurofin Genomics) TATCCACCTTTACTGTCAGTCCAGAGGCTCTTGCTTTATCCGG This paper N/A Recombinant DNA pNIC-NHStIIT vector Structural Genomics Consortium (SGC) N/A pCDF-LIC vector Structural Genomics Consortium (SGC) N/A pNIC28-Bsa4 vector Structural Genomics Consortium (SGC) Addgene Plasmid #26103 pCMVHA1-KCTD1 (cDNA for KCTD1 PCR) MRC PPU Plasmid DU42183 Software and algorithms PyMOL 2.3.4 The PyMOL Molecular Graphics System, Version 2.3 Schrödinger, LLC https://pymol.org/2/#download (Continued on next page) Structure 32, 1–8.e1–e4, October 3, 2024 e1

Techniques: Binding Assay

Figure 3. Iodide binding to KCTD1 CTD af- fects protein stability and TFAP2 binding (A) The KCTD1 pentamer displays an ion-binding channel in the CTD occupied by two sodium and two iodide ions (purple and green spheres, respectively). Inset slice shows 2Fo-Fc electron density map (gray) contoured at 1.0 s overlaid with iodide-specific anomalous map (brown) contoured at 5.0 s. (B) Apparent melting temperature of full-length KCTD1 at different halide ion salt concentrations. Protein was buffered in 25 mM HEPES pH 7.5, 0.05% Tween 20 plus indicated halide salts and SYPRO orange dye. Dilutions from 500 mM salt were mixed with NaH2PO4 pH 7.5 to maintain constant ionic strength. (C) BLI measurements of KCTD1 binding to im- mobilized TFAP2A peptide. Full-length KCTD1 protein was titrated up to 20 mM to assess binding buffered in 25 mM HEPES pH 7.5, 150 mM NaCl, 440 mM NaH2PO4 pH 7.5, 0.05% Tween 20, and indicated NaI concentrations. See also Figure S2.

Journal: Structure (London, England : 1993)

Article Title: A BTB extension and ion-binding domain contribute to the pentameric structure and TFAP2A binding of KCTD1.

doi: 10.1016/j.str.2024.07.023

Figure Lengend Snippet: Figure 3. Iodide binding to KCTD1 CTD af- fects protein stability and TFAP2 binding (A) The KCTD1 pentamer displays an ion-binding channel in the CTD occupied by two sodium and two iodide ions (purple and green spheres, respectively). Inset slice shows 2Fo-Fc electron density map (gray) contoured at 1.0 s overlaid with iodide-specific anomalous map (brown) contoured at 5.0 s. (B) Apparent melting temperature of full-length KCTD1 at different halide ion salt concentrations. Protein was buffered in 25 mM HEPES pH 7.5, 0.05% Tween 20 plus indicated halide salts and SYPRO orange dye. Dilutions from 500 mM salt were mixed with NaH2PO4 pH 7.5 to maintain constant ionic strength. (C) BLI measurements of KCTD1 binding to im- mobilized TFAP2A peptide. Full-length KCTD1 protein was titrated up to 20 mM to assess binding buffered in 25 mM HEPES pH 7.5, 150 mM NaCl, 440 mM NaH2PO4 pH 7.5, 0.05% Tween 20, and indicated NaI concentrations. See also Figure S2.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains E. coli BL21(DE3)R3-pRARE2 cells Structural Genomics Consortium (SGC) Addgene #26242 MACH T1 cells ThermoFisher C862003 Chemicals, peptides, and recombinant proteins Ni Sepharose High Performance histidine-tagged protein purification resin GE Healthcare 17526802 HiLoad 16/600 Superdex 200 pg Sigma Aldrich GE28-9893-35 Full length KCTD1 protein (a.a. 1–257) This paper N/A KCTD1DN27 protein (a.a. 28–257) This paper N/A KCTD1 BTB domain (a.a. 26–132) This paper N/A KCTD1 CTD domain (a.a. 132–257) This paper N/A TFAP2A peptide (Biotin-NADFQPPYFPPPYQ, Uniprot P05549-1 residues 50–63 This paper N/A Deposited data Structure of full-length KCTD1 (a.a. 1–257) This paper PDB: 9FOI Structure of KCTD1DN27 (a.a. 28–257) This paper PDB: 6S4L Oligonucleotides KCTD1 full length Fwd primer (Eurofin Genomics) TACTTCCAATCCATGTCAAGACCTCTGATCACTAGATCCCC This paper N/A KCTD1 full length Rev primer (Eurofin Genomics) TATCCACCTTTACTGTCAGTCCAGAGGCTCTTGCTTTATCCGG This paper N/A KCTD1DN27 Fwd primer (Eurofin Genomics) TACTTCCAATCCATGTCCAATGCGCCTGTCCACATTG This paper N/A KCTD1DN27 Rev primer (Eurofin Genomics) TATCCACCTTTACTGTCAGTCCAGAGGCTCTTGCTTTATCCGG This paper N/A KCTD1 BTB Fwd primer (Eurofin Genomics) TACTTCCAATCCATGACAAAATCCAATGCGCCTGTCCAC This paper N/A KCTD1 BTB Rev primer (Eurofin Genomics) TATCCACCTTTACTGTCATTCTCTGTCCTGCTTCCATCTTTCC This paper N/A KCTD1 CTD Fwd primer (Eurofin Genomics) TACTTCCAATCCATGGAAACTGGTCGATTTTCAAGGCCC This paper N/A KCTD1 CTD Rev primer (Eurofin Genomics) TATCCACCTTTACTGTCAGTCCAGAGGCTCTTGCTTTATCCGG This paper N/A Recombinant DNA pNIC-NHStIIT vector Structural Genomics Consortium (SGC) N/A pCDF-LIC vector Structural Genomics Consortium (SGC) N/A pNIC28-Bsa4 vector Structural Genomics Consortium (SGC) Addgene Plasmid #26103 pCMVHA1-KCTD1 (cDNA for KCTD1 PCR) MRC PPU Plasmid DU42183 Software and algorithms PyMOL 2.3.4 The PyMOL Molecular Graphics System, Version 2.3 Schrödinger, LLC https://pymol.org/2/#download (Continued on next page) Structure 32, 1–8.e1–e4, October 3, 2024 e1

Techniques: Binding Assay

Figure 4. KCTD1 CTD shares structural homology with GFRP (A) KCTD1 CTD pentamer (left) and subunit topology by rainbow colors (right). (B) Human GFRP pentamer (PDB 7AL9, left) and chain topology (right). Bound phenylalanine and potassium ions are shown as green sticks and gray spheres, respectively. (C) Superposition of KCTD1 CTD (rainbow) and GFRP (gray) chains. (D) Structure-based sequence alignment. See also Figure S3.

Journal: Structure (London, England : 1993)

Article Title: A BTB extension and ion-binding domain contribute to the pentameric structure and TFAP2A binding of KCTD1.

doi: 10.1016/j.str.2024.07.023

Figure Lengend Snippet: Figure 4. KCTD1 CTD shares structural homology with GFRP (A) KCTD1 CTD pentamer (left) and subunit topology by rainbow colors (right). (B) Human GFRP pentamer (PDB 7AL9, left) and chain topology (right). Bound phenylalanine and potassium ions are shown as green sticks and gray spheres, respectively. (C) Superposition of KCTD1 CTD (rainbow) and GFRP (gray) chains. (D) Structure-based sequence alignment. See also Figure S3.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains E. coli BL21(DE3)R3-pRARE2 cells Structural Genomics Consortium (SGC) Addgene #26242 MACH T1 cells ThermoFisher C862003 Chemicals, peptides, and recombinant proteins Ni Sepharose High Performance histidine-tagged protein purification resin GE Healthcare 17526802 HiLoad 16/600 Superdex 200 pg Sigma Aldrich GE28-9893-35 Full length KCTD1 protein (a.a. 1–257) This paper N/A KCTD1DN27 protein (a.a. 28–257) This paper N/A KCTD1 BTB domain (a.a. 26–132) This paper N/A KCTD1 CTD domain (a.a. 132–257) This paper N/A TFAP2A peptide (Biotin-NADFQPPYFPPPYQ, Uniprot P05549-1 residues 50–63 This paper N/A Deposited data Structure of full-length KCTD1 (a.a. 1–257) This paper PDB: 9FOI Structure of KCTD1DN27 (a.a. 28–257) This paper PDB: 6S4L Oligonucleotides KCTD1 full length Fwd primer (Eurofin Genomics) TACTTCCAATCCATGTCAAGACCTCTGATCACTAGATCCCC This paper N/A KCTD1 full length Rev primer (Eurofin Genomics) TATCCACCTTTACTGTCAGTCCAGAGGCTCTTGCTTTATCCGG This paper N/A KCTD1DN27 Fwd primer (Eurofin Genomics) TACTTCCAATCCATGTCCAATGCGCCTGTCCACATTG This paper N/A KCTD1DN27 Rev primer (Eurofin Genomics) TATCCACCTTTACTGTCAGTCCAGAGGCTCTTGCTTTATCCGG This paper N/A KCTD1 BTB Fwd primer (Eurofin Genomics) TACTTCCAATCCATGACAAAATCCAATGCGCCTGTCCAC This paper N/A KCTD1 BTB Rev primer (Eurofin Genomics) TATCCACCTTTACTGTCATTCTCTGTCCTGCTTCCATCTTTCC This paper N/A KCTD1 CTD Fwd primer (Eurofin Genomics) TACTTCCAATCCATGGAAACTGGTCGATTTTCAAGGCCC This paper N/A KCTD1 CTD Rev primer (Eurofin Genomics) TATCCACCTTTACTGTCAGTCCAGAGGCTCTTGCTTTATCCGG This paper N/A Recombinant DNA pNIC-NHStIIT vector Structural Genomics Consortium (SGC) N/A pCDF-LIC vector Structural Genomics Consortium (SGC) N/A pNIC28-Bsa4 vector Structural Genomics Consortium (SGC) Addgene Plasmid #26103 pCMVHA1-KCTD1 (cDNA for KCTD1 PCR) MRC PPU Plasmid DU42183 Software and algorithms PyMOL 2.3.4 The PyMOL Molecular Graphics System, Version 2.3 Schrödinger, LLC https://pymol.org/2/#download (Continued on next page) Structure 32, 1–8.e1–e4, October 3, 2024 e1

Techniques: Sequencing